SAMTools fillmd shows the insertions (as above) and mismatches (not in the example above) but not deletions. a deletion means a deletion in the read and an insertion is an insertion in the read, as you can see above. The CIGAR string (1M2D17M1I8M) is shown with respect to the read, i.e. #the -e changes identical bases between the read and reference into ='s The calmd or fillmd tool is useful for visualising mismatches and insertions in an alignment of a read to a reference genome. I wrote an entire post on my blog regarding this:, which also includes a Perl script for interpreting BAM flags. The trick is to convert the numerical digit into binary, and then use the table to interpret the binary numbers, where 1 = true and 0 = false. They may seem confusing at first but the encoding allows details about a read to be stored by just using a few digits. It can either act as a pipe reading stdin and writing. The second column in a SAM/BAM file is the flag column. scramble converts between various next-gen sequencing alignment file formats, including SAM, BAM and CRAM. See the section "Interpreting the BAM flags" below for more information on BAM flags. SRR035024.17204235 163 20 60126 60 68M8S = 60466 383 CCACCATGGACCTCTGGGATCCTAGCTTTAAGAGATCCCATCACCCACATGAACGTTTGAATTGACAGGGGGAGCG X0:i:1 X1:i:0 XC:i:68 MD:Z:68 RG:Z:SRR035024 AM:i:37 NM:i:0 SM:i:37 MQ:i:60 XT:A:U 83 20 60466 60 32S44M = 60126 -383 GGCCTCCCCCCGGGCCCCTCTTGTGTGCACACAGCACAGCCTCTACTGCTACACCTGAGTACTTTGCCAGTGGCCT #>D:LIJEJBJIFJJJJIHKIJJJIKHIHIKJJIJJKGIIFEDB X0:i:1 X1:i:0 XC:i:44 MD:Z:44 RG:Z:SRR035024 AM:i:37 NM:i:0 SM:i:37 MQ:i:60 XT:A:U more statistics of SAM/BAM files see the SAMStat program. Here's an example of a properly paired read:
0 kommentar(er)
